2026/6/21
Hossein Jahani-Azizabadi

Hossein Jahani-Azizabadi

Academic rank: Associate Professor
ORCID:
Education: PhD.
ResearchGate:
Faculty: Faculty of Agriculture
ScholarId:
E-mail: ho.jahani [at] uok.ac.ir
ScopusId: Link
Phone: 08733660067
H-Index:

Research

Title
Effect of supplemented diet by sucrose or starch on fungi populations in rumen fluid as determined by real-time polymerase chain reaction in Holstein steers
Type
Presentation
Keywords
fungi, real-time PCR, rumen
Year
2010
Researchers Alireza Vakili ، Mohsen Danesh Mesgaran ، Hossein Jahani-Azizabadi

Abstract

The objective of this work was to investigate the effect of diets containing different type of non-fiber carbohydrates (sucrose or starch) on fungi populations in rumen fluid as determined by real-time polymerase chain reaction. Four Holstein steers (BW = 280; SD = 15 kg) were assigned to a 4 × 4 Latin square with 21-d periods. A basal diet was formulated to be contained of alfalfa hay, barley grain, soybean meal and sugar beet pulp (400, 290, 190 and 50 g/ kg, respectively). Starch (St) or sucrose (Su) or a 1:1 mixture of starch and sucrose (St+Su) was added to the basal diet at the rate of 70g/kg DM. Diets were offered as 2–2.5 times of maintenance requirements (7 kg DM/d). Rumen fluid samples were collected before and 4 h after the morning feeding. DNA was extracted from the samples using the QIAamp DNA stool mini kit (Qiagen Ltd, Crawley, West Sussex, UK) following the manufacturer′s instructions. Fungi rDNA concentrations were measured by real time PCR relative to total bacteria amplification (ΔΔCt). The 16s rRNA gene-targeted primer sets used in the present study were forward: GAGGAAGTAAAAGTCGTAACAAGGTTTC and reverse: CAAATTCACAAAGGGTAGGATGATT. Cycling conditions were 95°C for 5 min, 40 cycles of 95°C for 15s, 60°C for 15s and 72°C for 30s; fluorescence readings were taken after each extension step, and a final melting analysis was obtained by heating at 0.1°C/s increment from 60 to 95°C, with fluorescence collection at 0.2°C at intervals. Data are expressed relative to quantification of the total bacterial population. Data were analyzed using mixed procedure of SAS (2003). Statistical model was: Yijk = μ+ Ti+ Cj+ Pk+ εijk, where Yijk is dependent variable, μ is the overall mean, Ti is treatment effect, Cj is cow effect, Pk is period effect, and εijk is error. The results of this experiment showed that different type of non-fiber carbohydrates didn’t have any effect on fungi populations before or 4 h after the morning feeding[St = 52 and 44,Su = 48 and 45, St+